The SAMI Project - South African Marine Invertebrates

Invertebrates: the building blocks of marine communities and ecosystems.

Parvulastra exigua  

Primary tabs

EOL Text

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 3 - 3
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Licensehttp://creativecommons.org/publicdomain/mark/1.0/
Rights holder/AuthorOcean Biogeographic Information System
Sourcehttp://www.iobis.org/mapper/?taxon_id=488433

Barcode data: Parvulastra exigua:

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 68 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AGACGATGATTCTTTTCTACCAAACACAAGGACATAGGAACCCTATATCTAATTTTTGGAGCCTGAGCCGGAATGGCCGGAACAGCCATGAGAGTAATAATACGAACAGAACTAGCCCAACCGGGGTCACTACTACAAGAT---GACCAAATATACAAAGTAATAGTTACCGCACACGCTCTAGTCATGATCTTTTTTATGGTGATGCCAATAATGATTGGAGGATTCGGAAATTGACTAATTCCCCTTATGATTGGAGCCCCAGACATGGCTTTCCCACGAATGAACAATATGAGCTTTTGACTAATACCCCCTTCCTTCCTTCTTCTTATTGCCTCAGCAGGAGTAGAAAGAGGTGCCGGAACAGGCTGAACAATATACCCCCCACTTTCTAGCGGACTAGCACATGCAGGAGGCTCCGTAGATCTTGCAATATTTTCACTTCACTTAGCAGGAGCCTCCTCGATACTTGCCTCTATCAAATTCATTACAACAGTTATTAAAATGCGAACCCCCGGTATGTCATTTGACCGACTCCCCCTATTCGTATGATCCGTATTCGTTACCGCCTTTCTTCTACTCCTATCACTTCCAGTGTTAGCCGGGGCAATTACCATGCTTCTCACAGACCGAAAAGTGAACACAACTTTCTTCGACCCTGCCGGAGGAGGGGACCCTATCTTGTTTCAACACCTATTCTGATTTTTTGGTCACCCCGAAGTCTACATCCTTATTCTCCCAGGATTCGGAATGATATCACATGTTATTGCCCACTACTCTGGAAAGAGAGAACCCTTCGGATACCTCGGAATGGTTTATGCCATAGTCTCTATCGGTATATTAGGATTCCTGGTATGAGCCCACCACATGTTCACGGTGGGAATGGACGTAGATACACGAG
-- end --


Download FASTA File

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=96298

Statistics of barcoding coverage: Parvulastra exigua:

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 68
Specimens with Barcodes: 71
Species With Barcodes: 1

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=96298

Parvulastra exigua:

Parvulastra exigua, or the dwarf cushion star[1] is a species of sea star. It can be found in temperate intertidal marine communities from geographically widespread sites around the southern hemisphere (including South Africa and Australia).



Description[edit]

Pentagonal body with no obvious protruding arms. Dorsal surface tiled with a small cluster of spines at each tile. Colour variegated, with bright patterns in orange, brown, green and white.[1]

Distribution[edit]

Namibia to Mozambique, intertidal to 3m, St Helena, St Paul and South Australia.[1]

Natural history[edit]

Intertidal and slightly deeper, well camouflaged. Feeds on microscopic algae by everting stomach onto substrate. No planktonic larval stage.[1]

References[edit]

  1. ^ a b c d Jones, Georgina. A field guide to the marine animals of the Cape Peninsula. SURG, Cape Town, 2008. ISBN978-0-620-41639-9
Wikimedia Commons has media related to Parvulastra exigua.

Licensehttp://creativecommons.org/licenses/by-sa/3.0/
Rights holder/AuthorWikipedia
Sourcehttp://en.wikipedia.org/w/index.php?title=Parvulastra_exigua&oldid=627312363
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith